DNA-analys på varg – process och teknik

I Viltskadecenters artikelserie om DNA-analys på våra rovdjur, är vi nu framme vid själva laboratoriearbetet. Så här går det till.

När ett DNA-prov har samlats in skickas det till Viltskadecenter som avgör, utifrån provets kvalitet, om det ska analyseras. I så fall skickas det vidare till ett DNA-labb vid Lunds universitet (Molecular Population Biology Lab), där DNA utvinns.

DNA-analysen går kortfattat till så här:

1. DNA från ett prov massdupliceras med hjälp av PCR-teknik.

2. DNA sekvenseras.

3. Den erhållna DNA-sekvensen jämförs med motsvarande sekvens hos andra
individer eller arter.

Från DNA kan rovdjuret artbestämmas. I cellernas mitokondrie-DNA finns gener som är identiska hos individer inom en rovdjursart, medan generna ser olika ut hos olika arter.

Ibland är det till och med möjligt att bestämma vilken individ som varit framme. För att skilja individer inom samma art används DNA från cellkärnan, där vissa delar är unikt hos varje individ.

Då det finns lagrade DNA-profiler från större delen av den skandinaviska vargstammen, vet vi precis vilka delar av DNA som ska användas för att identifiera individer eller fastställa släktskap genom prov från olika vargflockar.

 

Vad är DNA?

DNA (DeoxyriboNukleinSyra, eg. Acid) är en kemisk förening som fungerar som en ”genetisk kod”, en bruksanvisning till alla de proteiner våra kroppar behöver för att fungera.

DNA-molekylen är formad som en dubbelspiral, en vriden stege, där stegpinnarna består av par av fyra olika så kallade kvävebaser som förkortas A, T, C och G.

Eftersom A alltid binder till T och C alltid till G, är de två strängarna i princip spegelbilder av varandra. Vet man hur den högra strängen ser ut, kan man lätt räkna ut hur den vänstra strängen ser ut. Kombinationen av dessa kvävebaser styr vilka proteiner som bildas.

Kodande och icke-kodande DNA. 

Endast en tiondel av allt DNA kodar för dessa sekvenser av proteiner, större delen av de resterande 90 procenten är ”icke-kodande” DNA och har ingen känd funktion.

Skulle det uppstå en förändring – en mutation – i kodande DNA, fungerar inte genen som den ska och den nya varianten försvinner snart från populationen. Därför har de flesta individer liknande DNA-mönster i kodande gener.

Mutationer i icke-kodande DNA kan däremot finnas kvar och öka i frekvens, då det inte innebär att något protein förlorar sin funktion. Icke-kodande DNA varierar därför mellan individer. Det är dessa variationer man använder sig av för att identifiera och skilja individer åt och fastställa släktskap.

Här finns DNA. 

Varje cell i kroppen (utom i röda blodkroppar) innehåller en komplett uppsättning DNA (hos människor 46 DNA-molekyler, kromosomer).

Och varhelst vi lämnar ifrån oss några av våra celler så lämnar vi också små mängder DNA. Det finns på urtuggade tuggummin, cigarettfimpar, tappade hårstrån, i avföring och i droppar av blod.

Vargen som kliar sig mot ett träd lämnar ifrån sig ett DNA-spår i den lilla hårtussen som blir sittande kvar i barken. När vargen har dödat ett byte finns dess DNA kvar i såret på bytet. Avföring och löpblod innehåller också värdefulla spår av DNA.

Typer av prover från varg:

*På varje hårstrå sitter en hårsäck som innehåller DNA. Hårstrån utan hårsäck ger inget resultat.
Ett prov med en enda hårsäck ger oftas en mycket begränsad mängd DNA, om någon alls.
 Vid extraktion av hårstrån som tagits direkt från hundar använder Lunds Universitet ca 5-7 hårsäckar, vilket resulterar i rikligt med DNA.

 

Så går DNA-analysen till

DNA-prov som samlas in i naturen innehåller oftast för få celler för att vi ska kunna läsa den genetiska koden. Med hjälp av så kallad PCR-teknik kan man nu kopiera den del av DNA som vi är intresserade av, en så kallad markör.

Först då vi har miljontals kopior av markören kan vi läsa DNA-sekvensen bas för bas, bokstav för bokstav (AGTC) eller utveckla snabbare metoder för identifiering av art eller individ.

DNA-extraktion. DNA har längre hållbarhet i ren, löst form än vad det har inne i cellkärnan där det utsätts för olika nedbrytande enzymer.

För att komma åt DNA inne i cellkärnan måste man först spränga sönder cellerna, vilket görs med hjälp av ett enzym och värmebehandling. Nu gäller det att så snabbt som möjligt göra sig av med allt cellinnehåll, förutom DNA, innan enzymerna bryter ner det.

Separation av DNA. DNA och resterande cellinnehåll har olika kemiska egenskaper, som gör att det går att separera ämnena i olika faser. Metoden bygger på att fett och vatten inte blandar sig med varandra. Häller man ett par droppar matolja i ett glas vatten, lägger sig oljan som droppar på vattenytan. Fettlösliga ämnen hamnar i oljedropparna, medan vattenlösliga ämnen hamnar i vattenfasen.

I DNA-extraktionen hamnar därför DNA i den nedre vattenfasen, medan fettlösliga proteiner och annat ”skräp” hamnar i fettfasen. Om vi tar bort fettfasen så har vi kvar rent DNA, löst i vatten.

Då hållbarheten inte är den bästa i vattenlösning, vill vi bli av med vattnet och få ut DNA i fast form och sedan lösa det i en buffert som ger bra hållbarheten. Det är nu vi börjar blanda groggar.

Häller vi vattenlöst DNA i 99% sprit, fäller det ut (klumpar sig) till en vit tuss. DNA-molekylerna bildar små nystan som lägger sig på botten av röret, så att vi kan hälla bort spriten innan DNA löses i en buffert (skyddande lösning).

PCR-kopian. En PCR-apparat är egentligen en kopieringsmaskin som producerar miljontals kopior av en viss gen eller DNA-markör. Att stoppa in ett prov i PCR-apparaten är som att lägga en instruktionsbok på kopiatorns glasskiva och kopiera just de sidor man behöver.

För att veta vilka delar av DNA som ska kopieras, den specifika markören, använder man sig av primers, det vill säga ca 15-20 baser långa DNA-bitar som binder in till början av och markerar det DNA-avsnitt man vill kopiera.

PCR-reaktionen. En PCR-reaktion är en upprepad kopiering av en bestämd markör. Kör man kopieringen 25 gånger får man 225= 33 554 432 kopior av markören. Varje kopiering sker i tre steg och alla ingående komponenter stoppas i provröret från början.

Steg 1: Temperaturen höjs till 94°C, varvid DNA blir enkelsträngat, en förutsättning för att primern ska binda in till rätt ställe på prov-DNA.

Steg 2: Temperaturen sänks till ca 60°C (varierar beroende på hur väl primern passar till provet) då primern ”hittar” sitt ställe i DNA-provet. Där sätter sig den ena primern till rätta i början och den andra primern i slutet av DNA-markören. Primersekvensen AAAACCCCAAAACCCCGGGG kommer att fastna på en bit enkelsträngat DNA som har sekvensen CCCCGGGGTTTTGGGGTTTT (A och T binder till varandra och G och C till varandra).

Steg 3: Temperaturen höjs till 72°C och själva byggandet, kopieringen tar fart. Det är nu som Taq-polymeraset läser DNA-sekvensen från primern och sätter in nya A, T, C och G. I slutet av detta steg har det bildats en ny DNA-sträng som är ett exakt komplement av den enkelsträngade DNA-sekvens vi vill undersöka i vårt prov.

Primers. 

En av de viktigaste faktorerna för en fungerande PCR-reaktion är att primern binder in på rätt ställe på DNA-molekylen.

För att veta hur den 15-20 baser långa primern ska se ut, krävs att man har sekvensen för den aktuella DNA-regionen exempelvis cyt B-regionen för varg, i annat fall kan man oftast hitta den på GenBank, en databas där alla publicerade DNA-sekvenser lagras och görs tillgängliga för allmänheten.

Utifrån markörens sekvens, letar man fram en lämplig region att kopiera, och designar sedan två primers (i början och slutet av regionen). Lämplig region kan exempelvis vara en region med lagom mycket variation för att skilja olika arter eller indivder åt.

 

 

Förenklat exempel på design av primers.

 

Tolkning av provet

Att skilja arter åt. I våra celler skiljer vi på två typer av DNA, nukleärt DNA och mitokondrie DNA (mtDNA).

Medan nukleärt DNA ligger hopnystat till ett antal kromosomer i cellkärnan och utgör majoriteten av cellens DNA, finns mtDNA inne i cellens energiproducenter, mitokondrierna, som ligger som enskilda organeller i cellen.

Här omvandlas energin från den mat vi äter, till energi som är tillgänglig för kroppens alla funktioner.

Mitokondrierna har sitt ursprung i bakterier, som tagit sig in våra tidiga förfäders celler och successivt blivit en del av värdens celler. Därför har mtDNA större likheter med bakterie-DNA än med däggdjurs-DNA. MtDNA skiljer sig från nukleärt DNA genom att:

1. det ärvs endast från mamman (eftersom ägg, men inte spermier innehåller mitokondrier) och

2. det har en högre mutationshastighet på grund av sämre reparationsmekanismer.

Generna i mtDNA kodar för proteiner som behövs just vid energiomvandlingen – livsviktiga proteiner som ofta ser identiska ut hos alla flercelliga organismer. Detta innebär att generna i mitokondrierna inte har ändrat sig särskilt mycket under evolutionens gång.

Vanligtvis är alla individer inom en art identiska på dessa gener, medan olika arter kan skilja sig åt på enstaka baser. En av dessa gener, den så kallade cytokrom B-genen har precis lagom stor variation för att lämpa sig som markör för att skilja olika arter åt.

På Viltskadecenter används cytokrom B-genen för att bestämma vilken rovdjursart som dödat ett bytesdjur. Enstaka mutationer i genen (skillnader i bassammansättning) mellan rovdjursarterna gör att man kan se om saliven kommer från varg, lodjur eller björn.

 

Att skilja individer från varandra

För att kunna skilja individer inom samma art måste vi använda delar av DNA som har stor variation, där varje individ har sin egen unika kod. Mikrosatelliter som har en hög mutationsfrekvens (snabb förändring av DNA-koden), är perfekta för detta ändamål.

Varje mikrosatellit består av hundratals kopior av två till sex baser långa sekvenser, exempelvis ACACACACAC upprepat ett stort antal gånger. Det är antalet upprepningar som varierar mellan individer.

Dessvärre ger en enda mikrosatellit inte tillräcklig information för att med säkerhet särskilja individer. Optimalt vore ett trettiotal olika mikrosatelliter, men med bakgrundsinformation om den aktuella arten och populationen, räcker det ofta med ett tiotal väl utvalda mikrosatellitmarkörer.

Då det finns DNA-profiler från större delen av Sveriges vargstam, vet vi precis vilka mikrosatelliter som fungerar för att identifiera individer eller fastställa släktskap på ett avförings- eller salivprov från olika vargflockar. Beroende på vilken del av landet provet kommer ifrån, varierar sammansättningen av de valda mikrosatelliterna för ett prov.

Eftersom DNA samlas in av olika personer och olika lång tid efter att djuret lämnat ifrån sig ett DNA-spår, varierar kvaliteten och mängden DNA i de insamlade proverna. För att få ett säkert resultat analyseras därför varje prov fyra gånger på varje markör. Detta kräver relativt stora mängder DNA, något man inte alltid lyckas med vid provtagning.

 

Faktorer som påverkar provsvaret

När man samlat in ett avföringsprov, en hårtuss, ett salivprov eller dylikt och skickat iväg det för DNA-analys får man efter några veckor svar på vilken art eller individ provet härrörde från.

Ibland händer det tyvärr att analysen inte ger något resultat, vilket innebär att det inte gått att få fram en tillräckligt tillförlitlig DNA-profil för att art eller individ kan fastställas. Varför blir det så? Är det själva provtagningen, hanteringen av provet eller något på labbet som falerat?

Tyvärr går det inte alltid att utifrån ett blankt resultat se vad som faktiskt gått fel. Men de vanligaste och mest sannolika orsakerna är följande:

1. att kvalitén på DNA varit för låg eller mängden högkvalitativt DNA varit för liten.

2. att metoden som används på laboratoriet inte är anpassad till just den individ eller art som provet härrör från.

 

Kvaliteten på provets DNA

Väl fungerande PCR-reaktioner kräver att provet innehåller DNA av tillräcklig mängd och kvalitet. Så snart DNA-molekylen lämnar cellkärnans eller mitokondriens skyddande miljö utsätts den för olika nedbrytande faktorer, såsom cellens enzymer, solens UV-strålar, kroppsvätskor och andra ämnen från den omgivande miljön.

Genom att torka, frysa in eller förvara provet i skyddande lösning (buffert) fördröjs nedbrytningen markant. Hanteringen av provet innan det kommer till labbet är alltså oerhört viktig för analysresultatet. Vanligtvis kan man vid analysen se om provet innehållit för lite användbart DNA.

Ju kortare tid ett DNA-prov är utsatt för nedbrytande faktorer som solljus och kemiska substanser, desto större är sannolikheten att det går att analysera. Ett prov som samlats in och konserverats direkt genom förvaring i skyddande buffertlösning, torkning eller nedfrysning och som analyseras så snart som möjligt efter insamlandet har goda möjligheter att ge ett robust svar.

Förutom hanteringen av provet är själva insamlandet avgörande för analysernas slutresultat. För att få ett resultat är det nödvändigt att provet från början verkligen innehåller DNA. I ett hårstrå finns det exempelvis bara DNA i hårsäcken och en hårtuss utan hårsäckar ger inget analysresultat.

Ett prov från ett bitsår på ett bytesdjur som av slumpen skrapats på ett ställe där rovdjuret inte lämnat ifrån sig saliv innehåller inget rovdjurs-DNA och ger heller inget resultat.

 DNA är ett känsligt ämne med begränsad hållbarhet. Liksom hållbarheten hos livsmedel kan förlängas med olika konserveringsmetoder, kan hållbarheten hos DNA förlängas om det hanteras på rätt sätt.

DNA härsknar eller möglar dock inte, utan de långa dubbelspiralerna kan helt enkelt gå sönder, ”brytas ner”, vid felaktig hantering.

UV-ljus är exempelvis en effektiv nedbrytare av DNA, liksom upprepad infrysning och upptining av DNA. När DNA brutits ner i alltför små bitar går det inte att analysera.

 Att bevara DNA-prover i oändlig tid på labb är inga problem, med tillgång till mörka skåp och frysboxar. Problemet är att provet kan brytas ner under transport från insamlingen i fält till labbets frysboxar.

Det gäller alltså att DNA-provet i samband med insamlandet konserveras på ett effektivt sätt. Olika typer av DNA-prov behandlas på olika sätt. Topz som skrapats i ett bitsår för insamling av saliv från rovdjur, torkas några minuter i luften, innan den stoppas i provrör. Avföringsprov fryses in snarast efter insamlandet. Blodprover hälls ner i en konserverande lösning.

Rent generellt är det lättare att identifiera art än att bestämma individ. Detta beror bland annat på att man vid artbestämning använder DNA från cellens mitokondrier (mtDNA), som det finns flera av i en enda cell, medan man vid individbestämning använder DNA från cellkärnan som det bara finns en kopia av.

Analyser av mtDNA är alltså på grund av den större mängden DNA mindre känsligt för nedbrytning. Prov med små mängder DNA, eller delvis nedbrutet DNA, duger ofta för en artbestämning, medan individbestämning av ett sådant prov är betydligt svårare.

Analysmetoderna

. DNA-analyserna fungerar dessvärre inte alltid perfekt. PCR-reaktionen är ofta anpassad för en viss art, men eftersom olika individer inom denna art kan skilja sig åt genetiskt, händer det att reaktionen inte fungerar på alla individer.

Det händer också exempelvis att ett prov, insamlat som kommande från varg, i själva verket kom från ett annat rovdjur, vilket ger ett blankt resultat på labbet, som det kan bli svårt att hitta orsaken till.

 

 

Category: Basfakta, Vargfakta · Tags:

Comments are closed.

Stöd vårt arbete

Tycker du att vargfakta.se gör ett bra jobb? Stöd vårt arbete genom valfritt bidrag till BG 5723-2571 meddelande VARGFAKTA

Kort om vargfakta

Vargfakta publicerar analyser, nyheter och forskning om och kring rovdjur och dess interaktion med människan. Vi ser människan som en resurs för naturen och inte som en belastning.

Kontakt

Via mail på info@vargfakta.se